Lab Oligos
Common oligos that are useful for the whole lab.
1. Storage
Section titled “1. Storage”The box is kept in -80C freezer, near the common lab plasmids. Oligos should be stored in Te (10 mM TrisCl pH 8, 0.1 mM EDTA) at a concentration of 100 µM. If the oligo concentration or storage buffer are different, please indicate so on the tube.
2. Oligo list
Section titled “2. Oligo list”| Name | Sequence | Notes |
|---|---|---|
| LAB01 | TTG TAC ACG GCC GCA TAA TC | Primer, useful for DNA sequencing or colony PCR from pInteinHis and related plasmids. Ilya’s oligo: IF034 |
| LAB02 | GAT GGC GTT GTC ACT GTT GG | Primer that anneals to the Chitin Binding domain in pInteinHis and related plasmids. Ilya’s oligo: IF012 |
| LAB03 | ATG CGT CCG GCG TAG A | pETDuet Upstream sequencing primer, useful for DNA sequencing or colony PCR from pInteinHis and derivatives. Ilya’s oligo: IF033 |
| LAB04 | ATG CCA TAG CAT TTT TAT CC | Forward primer for pbad322 and derivatives. Ilya’s oligo: IF059 |
| LAB05 | GAT TTA ATC TGT ATC AGG | Reverse primer for pbad322 and derivatives. Ilya’s oligo: IF060 |
| LAB06 | /5Phos/GGG CGG CGA CCT/3BioTEG | For Lambda DNA Oligo Ligation using Heat Block. Ilya’s oligo: IF001 |
| LAB07 | /5Phos/AGG TCG CCG CCC/3BioTEG | For Lambda DNA Oligo Ligation using Heat Block. Ilya’s oligo: IF003 |
| LAB08 | /5Phos/AGG TCG CCG CCC/3Dig_N | For Lambda DNA Oligo Ligation using Heat Block. Ilya’s oligo: IF002 |
| LAB09 | /5Phos/GGG CGG CGA CCT/3Dig_N | For Lambda DNA Oligo Ligation using Heat Block. Ilya’s oligo: IF004 |
| LAB010 | CGGTTAGCTCCTTCGGTCCT | For AmpR PCR confirmation. Ilya’s oligo: IF023 |
| LAB011 | TGCGGCCAACTTACTTCTGA | For AmpR PCR confirmation. Ilya’s oligo: IF024 |
| LO01M13 | GTA AAA CGA CGG CCA GT | For ssM13 DNA |
| LO02M13 | GTT TTC CCA GTC ACG AC | For ssM13 DNA |
| LO03M13 | GGA AAC AGC TAT GAC CAT G | For ssM13 DNA |
| LO04M13 | AGC GGA TAA CAA TTT CAC ACA GGA | For ss M13 DNA |